| Home | E-Submission | Sitemap | Contact us |  
top_img
Korean J Parasitol > Volume 57(2):2019 > Article
Jiang, Choi, Kim, Kim, Klein, Chong, Richards, Park, Shin, Song, Park, and Jang: Distribution of Rickettsia spp. in Ticks from Northwestern and Southwestern Provinces, Republic of Korea

Abstract

This study was done to characterize distribution of Rickettsia spp. in ticks in the northwestern and southwestern provinces in the Republic of Korea. A total of 2,814 ticks were collected between May and September 2009. After pooling, 284 tick DNA samples were screened for a gene of Rickettsia-specific 17-kDa protein using nested PCR (nPCR), and produced 88 nPCR positive samples. Of these positives, 75% contained 190-kDa outer membrane protein gene (ompA), 50% 120-kDa outer membrane protein gene (ompB), and 64.7% gene D (sca4). The nPCR products of ompA, ompB, and sca4 genes revealed close relatedness to Rickettsia japonica, R. heilongjiangensis, and R. monacensis. Most Rickettsia species were detected in Haemaphysalis longicornis. This tick was found a dominant vector of rickettsiae in the study regions in the Republic of Korea.

INTRODUCTION

Spotted fever group rickettsiae (SFGR) are obligatory intracellular bacteria commonly found in arthropods such as ticks. Some of the SFGR cause rickettsioses after arthropods transmit them to animals and humans. Common clinical symptoms of SFG rickettsioses are fever, headache, and rash [1]. Currently, SFGR comprise more than 30 species classified into multiple genogroups including: Rickettsia japonica - R. heilongjiangensis; R. massiliae including R. montanensis; R. helvetica including R. tamurae and R. monacensis; and R. akari [2]. Members of the R. japonica - R. heilongjiangensis genogroup have been detected in Japan and the Far East [3]. Specifically, the first clinical case of R. japonica was known in Japan in 1984. It was reported as Japanese spotted fever [3,4]. Since then, it has been detected in Japan, the Philippines, the Republic of Korea, and Thailand [58].
R. heilongjiangensis was first isolated from Dysmicoccus sylvarum ticks in Heilongjiang Province of China in 1983. It belongs to R. japonica subgroup of SFGR [10]. Rickettsioses caused by R. heilongjiangensis have appeared in China, Russia, Kazakhstan, and Japan [912].
In the Republic of Korea, a variety of SFGR including R. japonica, R. conorii, R. akari, R. australis, and R. monacensis have been reported over 15 years ago [1318]. R. japonica was first detected from Haemaphysalis spp. ticks in 2003 and human sera in 2004 while R. monacensis was first detected from Haemaphysalis spp. ticks in 2009 [13,14,18]. Additionally, various unidentified Rickettsia spp. were detected in ticks from 5 provinces (including Jeolla-do) during 2011–2013 [19].
Recently, various Rickettsia spp. in other countries have been reported. Nine species or subspecies of tick-borne rickettsiae have been identified in China in the past 30 years [21]. Guo et al. [22] first reported on the existence of R. raoultii in H. erinacei from wild marbled polecat (Vormela peregusna) in China in 2014. It may be assumed that there is a need to examine geographical features (i.g. China-Kazakhstan border) in the identification of various Rickettsia species [21]. Also, since tick-borne disease can be prevalent throughout the country due to climate change, it is important to investigate seasonal occurrence and status of ticks to predict the potential of transovarial transmission [22]. Therefore, the objective of this study was to identify and characterize rickettsiae in ticks collected at different geographical regions in the Republic of Korea.

MATERIALS AND METHODS

Collecting and identifying ticks

All ticks were collected using tick dragging in the northwestern province (4 regions in Incheon-si, including Gangwha-do (37°44′10.5″N/126°31′47.5″E and 37°45′02.9″N/126°25′26.9″E), Samsung-dong (37°43′47.9″N/126°29′36.6″E), Gilsang-myeon (37°37′31.1″N/126°29′34.1″E), and Bureun-myeon (37°37′04.6″N/126°28′35.3″E)) and 2 southwestern provinces (3 regions in Jeolla-do: Muan (34°51′06.9″N/126°25′03.8″E), Haenam (34°35.68.6″N/126°38.45.3″E and 34°34.01.8″N/ 126°38.16.1″E), and Gochang (36°35′67.6″N/126°33′55.7″E); and 3 regions in Chungcheong-do: Seosan (36°44′26.0″N/ 126°34′05.0″E), Chungju (37°01′43.3′ ′N/127°50′50.0″E), and Jecheon (37°13′39.5″N/128°05′11.5″E) in Republic of Korea from May to September of 2009 (Fig. 1). Ticks were identified and their developmental stages such as larva, nymph, adult male, and adult female were determined under a stereomicroscope. Pooled tick samples were transferred to 2 ml microcentrifuge screw-cap tubes and stored at −70°C.

DNA extraction

Pooled tick samples were washed with 70% ethanol and rinsed with distilled water. Total DNAs were extracted from these samples using G spin total DNA extraction kit (iNtRON, Gyeonggi, Korea) according to the manufacture’s introductions. DNA samples were stored at −20°C until use for DNA amplification.

nPCR to detect rickettsial agents

First, we performed nPCR screening to select positive DNA samples using specific primers for 17-kDa gene: R17K31F (GCTCTTGCAGCTTCTATGTTACA) and Rr2608R (CATTGTCCGTCAGGTTGGCG). The reaction mixture was prepared by adding 2 μl DNA extract and 8 pmole of each primer into a tube of AccuPower® PCR premix (Bioneer Corp., Daejeon, Korea) composed of 1U Taq DNA polymerase, 250 μM dNTP, 50 mM Tris-HCl (pH 8.3), 40 mM KCl, and 1.5 mM MgCl2. After adjusting the final volume to 20 μl with distilled water, and PCR reaction was performed on a VeritiTM 96-well Thermal Cycler (Applied Biosystems, Carlsbad, California, USA).

Amplification of partial ompA/B and sca4

To amplify partial ompA, ompB, and sca4 genes from SFG Rickettsia positive DNA samples, nPCR was performed. Primers are listed in Table 1.

Sequencing analysis

To identify Rickettsia species by sequencing, we used ompA primers (Table 1). Sequencing was performed by Genotech Co. Ltd. (Daejeon, Korea). To acquire partial ompA nucleotide sequences, all samples were sequenced in duplicates. Sequence analyses were performed with MegAlign software (DNAStar, Madison, Wisconsin, USA).

RESULTS

Tick collection

A total of 2,814 ticks were collected from 3 provinces in the Republic of Korea in May 2009, including 1,056 H. flava, 1,725 H. longicornis, 32 I. nipponensis, and one A. testudinarium. These ticks consisted of 1,994 (70.8%) larvae, 791 (28.1%) nymphs, 16 (0.5%) adult males, and 13 (0.4%) adult females. Dominant species were H. longicornis (61.3%) followed by H. flava (37.5%) and I. nipponensis (Table 2).

Amplification and sequencing for rickettsial agent identifications

nPCR screening of 284 tick pools identified 88 (30.9%) positive samples using rickettsial 17-kDa antigen gene-specific primers. These nPCR positive samples were used for nPCR amplification of ompA, ompB, and sca4 genes. nPCR results showed that 66 (75.0%), 44 (50.0%), and 57 (64.7%) samples were positive for ompA, ompB, and sca4, respectively (Table 3).
Subsequently, we randomly selected 30 nPCR positive samples (10 from northwestern and 20 from southwestern province) for ompA gene to performed sequencing analysis.
Sequences of ompA from 2 H. flava pool samples collected from Jeolla-do shared 97.8–99.1% similarities with those of R. heilongjiangensis. Most of 27 H. longicornis pools shared 97.8–98.8% sequence similarities with R. heilongjiangensis while 1 H. longicornis tick pool shared 99.9% sequence similarity with R. monacensis (Fig. 2). R. monacensis was first detected in I. nipponensis collected from Jeolla-do, Gyeonggi-do, and Gangwon-do [22,23]. Interestingly, R. monacensis was first detected in H. longicornis collected from Incheon metropolitan city of a northwestern province.

DISCUSSION

First cases of Far East spotted fever (FESF) caused by R. heilongjiangensis have been reported in Russia and China [24]. Rickettsiae from ticks collected in Korea in 2003 [13] showed high sequence similarities with R. japonica YH (GenBank accession number: AP011533). R. japonica was detected in Korean human sera in 2004 and 2005 [14,16].
Although this study was limited to a short period of 5 months, most tick-related pathogens such as tick-borne pathogens found in other Korean studies [19,26,27] were commonly detected in Southern provinces such as Jeolla-do and Chungcheong-do that were also included in the present study.
To obtain more data on the distribution of rickettsiae, we investigated species of Rickettsia from ticks in 2 provinces of Republic of Korea. In particular, the number of ticks collected from Incheon metropolitan city was more than that collected from other regions and H. longicornis predominated. Its number collected from Incheon metropolitan city was twice of that collected from Jeolla-do and 9 times of that collected from Chungcheong-do.
Incheon metropolitan city is located in the northwestern part of Seoul. It is the third largest city after Seoul and Busan in Republic of Korea. Interestingly, the 8 areas of Incheon-si where ticks were collected were mostly flat areas not exceeding 100 m in height with a humid subtropical climate [28,29]. This environment is a suitable place for the survival of tick vectors and the area with low grass height may be advantageous for human and vector contact. This shows the potential that human infections can be caused by ticks in urban areas. It also reminds us that we need to continuously monitor geographical changes of vector distribution and disease incidence.
In summary, we used nucleic acids and found that rickettsial agents from Ixodid ticks collected from northwestern and southwestern provinces of the Republic of Korea were closely related to R. heilongjiangensis, R. japonica, and R. monacensis.

ACKNOWLEDGMENTS

Yeon-Joo Choi and Ju Jiang contributed equally. Funding for portions of this work was provided by the Armed Forces Health Surveillance Branch-Global Emerging Infections Surveillance and Response System (AFHSB-GEIS), Silver Spring, Maryland, USA. The views expressed in this article are those of the authors do not reflect the official policy or position of the Department of the Navy, the Department of the Army, the Department of Defense, nor the US Government.

CONFLICT OF INTEREST

CONFLICT OF INTEREST
The authors declare that they have no conflict of interest.

REFERENCES

1. Maurin M, Raoult D. Bacteriostatic and bactericidal activity of levofloxacin against Rickettsia rickettsii, Rickettsia cornorii, ‘Israeli spotted fever group rickettsia’ and Coxiella burnetii . J Antimicrob Chemoth 1997;39: 725-730.
crossref pdf
2. Shpynov SN, Fournier PE, Pozdnichenko NN, Gumenuk AS, Skiba AA. New approaches in the systematics of rickettsiae. New Microbes New infect 2018;23: 93-102.
crossref pmid pmc
3. Mahara F. Rickettsioses in Japan and the far East. Ann NY Acad Sci 2006;1078: 60-73.
crossref pmid
4. Uchida T, Tashiro F, Funato T, Kitamura Y. Isolation of a spotted fever group Rickettsia from a patient with febrile exanthematous illness in Shikoku, Japan. Microbiol Immunol 1986;30: 1323-1326.
crossref pmid
5. Uchida T, Uchiyama T, Kumano K, Walker DH. Rickettsia japonica sp. nov., the etiological agent of spotted fever group rickettsiosis in Japan. Int J Syst Bacteriol 1992;42: 303-305.
crossref pmid
6. Camer A, Masangkay J, Satoh H, Okabayashi T, Norizuki S, Motoi Y, Ueno H, Morita C. Prevalence of spotted fever rickettsial antibodies in dogs and rodents in the Philippines. Jpn J Infect Dis 2000;53: 162-163.
pmid
7. Chung MH, Lee SH, Kim MJ, Lee JH, Kim ES, Kim MK, Park MY, Kang JS. Japanese spotted fever, South Korea. Emerg Infect Dis 2006;12: 1122-1124.
crossref pmid pmc
8. Gaywee J, Sunyakumthorn P, Rodkvamtook W, Ruang-areerate T, Mason CJ, Sirisopana N. Human infection with Rickettsia sp. related to R. japonica, Thailand. Emerg Infect Dis 2007;13: 657-659.
crossref pmc
9. Fournier PE, Dumler JS, Greub G, Zhang J, Wu Y, Raoult D. Gene sequence-based criteria for identification of new rickettsia isolates and description of Rickettsia heilongjiangensis sp. nov. J Clin Microbiol 2003;41: 5456-5465.
crossref pmid pmc
10. Jiao Y, Wen B, Chen M, Niu D, Zhang J, Qiu L. Analysis of immunoprotectivity of the recombinant OmpA of Rickettsia heilongjiangensis . Ann NY Acad Sci 2005;1063: 261-265.
crossref pmid
11. Mediannikov OY, Sidelnikov Y, Ivanov L, Mokretosova E, Fournier PE, Tarasevich I, Raoult D. Acute tick-borne rickettsiosis caused by Rickettsia heilongjiangensis in Russian Far East. Emerg Infect Dis 2004;10: 810-817.
crossref pmid pmc
12. Rudakov N, Shpynov S, Fournier PE, Raoult D. Ecology and molecular epidemiology of tick-borne rickettsioses and anaplasmoses with natural foci in Russia and Kazakhstan. Ann NY Acad Sci 2006;1078: 299-304.
crossref pmid
13. Ando S, Kurosawa M, Sakata A, Fujita H, Sakai K, Sekine M, Katsumi M, Saitou W, Yano Y, Takada N, Takano A, Kawabata H, Hanaoka N, Watanabe H, Kurane I, Kishimoto T. Human Rickettsia heilongjiangensis infection, Japan. Emerg Infect Dis 2010;16: 1306-1308.
crossref pmid pmc
14. Lee JH, Park HS, Jung KD, Jang WJ, Koh SE, Kang SS, Lee IY, Lee WJ, Kim BJ, Kook YH, Park KH, Lee SH. Identification of the spotted fever group rickettsiae detected from Haemaphysalis longicornis in Korea. Microbiol Immunol 2003;47: 301-304.
crossref pmid
15. Jang WJ, Choi YJ, Kim JH, Jung KD, Ryu JS, Lee SH, Yoo CK, Paik HS, Choi MS, Park KH, Kim IS. Seroepidemiology of spotted fever group and typhus group rickettsioses in humans, South Korea. Microbiol Immunol 2005;49: 17-24.
crossref pmid
16. Faccini-Martínez ÁA, García-Álvarez L, Hidalgo M, Oteo JA. Syndromic classification of rickettioses: an approach for clinical practice. Int J Infect Dis 2014;28: 126-139.
crossref pmid
17. Choi YJ, Jang WJ, Ryu JS, Lee SH, Park KH, Paik HS, Koh YS, Choi MS, Kim IS. Spotted fever group and typhus group rickettsioses in humans, South Korea. Emerg Infect Dis 2005;11: 237-244.
crossref pmid pmc
18. Choi YJ, Lee EM, Park JM, Lee KM, Han SH, Kim JK, Lee SH, Song HJ, Choi MS, Kim IS, Park KH, Jang WJ. Molecular detection of various rickettsiae in mites (acari: trombiculidae) in southern Jeolla Province, Korea. Microbiol Immunol 2007;51: 307-312.
crossref pmid
19. Moon BC, Jeong JH, Choi YJ, Kim JE, Seo HJ, Shin EH, Song BG, Lee SH, Park KH, Jang WJ. Detection and identification of the spotted fever group rickettsial agents from Haemaphysalis ticks in Jeju Island, Korea. J Bacteriol Virol 2009;39: 317-327 (in Korean).
crossref
20. Kang SW, Doan HT, Choe SE, Noh JH, Yoo MS, Reddy KE, Kim YH, Kwon CH, Jung SC, Chang KY. Molecular investigation of tick-borne pathogens in ticks from grazing cattle in Korea. Parasitol Int 2013;62: 246-282.
crossref pmid
21. Liu H, Zhang X, Li Z, Wang Z, Song M, Wei F, Wang S, Liu Q. Characterization of rickettsiae in ticks in northeastern China. Parasit Vectors 2016;9: 498.
crossref pmid pmc pdf
22. Guo LP, Mu LM, Xu J, Jiang SH, Wang AD, Chen CF, Guo G, Zhang WJ, Wang YZ. Rickettsia raoultii in Haemaphysalis erinacei from marbled polecats, China-Kazakhstan border. Parasit Vectors 2015;8: 461.
crossref pmid pmc
23. Shin YC, Lee IY, Seo JH. Seasonal patterns of ticks in Pocheon and Cheolwon, Republic of Korea. Korean J Clin Lab Sci 2015;47: 147-152 (in Korean).
crossref pdf
24. Kim YS, Choi YJ, Lee KM, Ahn KJ, Kim HC, Klein T, Jiang J, Richards A, Park KH, Jang WJ. First isolation of Rickettsia monacensis from a patient in South Korea. Microbiol Immunol 2017;61: 258-263.
crossref pmid
25. Parola P, Paddock CD, Raoult D. Tick-borne rickettsioses around the world: emerging diseases challenging old concepts. Clin Microbiol Rev 2005;18: 719-756.
crossref pmid pmc
26. Coburn JM, Chong ST, Kim HC, Chang NW, Calix LC, Resto K, Lee DJ, Johnson JL, Robbins RG, Klein TA. Tick surveillance in four southwestern provinces of the Republic of Korea during 2013. Syst Appl Acarol 2016;21: 147-165.

27. Noh YT, Lee YS, Kim HC, Chong ST, Klein TA, Jiang Ju, Richards AL, Lee HK, Kim SY. Molecular detection of Rickettsia species in ticks collected from the southern provinces of Republic of Korea. Parasit Vectors 2017;10: 20.
crossref pmid pmc pdf
28. Peel MC, Finlayson BL, McMahon TA. Updated world map of the Köppen-Geiger climate classification. Hydrol Earth Syst 2007;11: 1633-1644.
crossref pdf
29. Korea Meteorological Administration. Incheon metropolitan city, Normal year data (1981–2010) [Internet]; [Retrieved 8 December 2016]. Available from: http://www.weather.go.kr/weather/climate/past_cal.jsp .

Fig. 1
Map of the tick sampling sites. Ticks were collected in the northwestern (Incheon-si) and southwestern (Chungcheong-do, Jeolla-do) provinces of Korea.
kjp-57-2-161f1.jpg
Fig. 2
Phylogenic tree representing phylogenetic relationships between partial ompA sequence of various rickettsial strains and 625 bp of ompA product amplified from 30 selected DNA samples. The phylogenetic tree was constructed using MegAlign software and Bootstrap analysis was performed with 1,000 replicates.
kjp-57-2-161f2.jpg
Table 1
Oligonucleotide primers used for detection of Rickettsia ompA, ompB and sca4
Target gene Primer Nucleotide sequence (5′→3 ′) Product size (bp) PCR condition (°C/sec)

Denaturation Annealing Extension Cycles
ompA 190-70Fb ATGGCGAATATTTCTCCAAAA 645 94 50 72 40
RompA642Ra,b ATTACCTATTGTTCCGTTAATGGCA 30 30 45
190-3588F AACAGTGAATGTAGGAGCAG 845 94 42 72 40
RompARm4433Ra,b,c GAATTTAAGGTTACTATACCTTC 30 30 50

ompB RompB11F ACCATAGTAGCMAGTTTTGCAG 1,892 94 50 72 40
RompB1902Ra CCGTCATTTCCAATAACTAACTC 30 30 120
RompBRm11Fc RCCATAGTRGCCAGTTKTGCAG 1,846 94 50 72 40
RompBRm1902Ra,c CCGTMATTTCCAATAACTAACTC 30 30 110

sca4 RrD928F ATTTATACACTTGCGGTAACAC 1,758 94 45 72 40
RrD2685Ra TTCAGTAGAAGATTTAGTACCAAAT 30 30 110
RrDRm1826Ra,c TCTAAATTCTGTTGCATCAAT

ompA, outer membrane protein A gene; ompB, outer membrane protein B gene, sca4, surface cell antigen gene.

a Reverse orientation.

b Primers for sequencing.

c Specially designed primer for R. monacensis.

Table 2
Summary on tick species, stage and 17-kDa positive nPCR collected from 3 projected regions
Province Species Stage No. of ticks (No. of tested pools) No. of 17-kDa PCR positive (%)
Incheon H. flava Larvaa 654 (24) 0 (0)
Nymphb 25 (6) 2 (8.0)
Adult (male)c 1 (1) 0 (0)
Adult (female)c 0 (0) 0 (0)
H. longicornis Larvaa 1,080 (39) 23 (2.1)
Nymphb 12 (7) 4 (33.3)
Adult (male)c 6 (6) 3 (50.0)
Adult (female)c 3 (3) 1 (33.3)
I. nipponensis Larvaa 3 (1) 0 (0)
Nymphb 0 (0) 0 (0)
Adult (male)c 0 (0) 0 (0)
Adult (female)c 0 (0) 0 (0)

Chungcheong-do H. flava Larvaa 127 (5) 0 (0)
Nymphb 74 (17) 4 (5.4)
Adult (male)c 2 (2) 0 (0)
Adult (female)c 0 (0) 0 (0)
H. longicornis Larvaa 88 (3) 0 (0)
Nymphb 30 (7) 2 (6.7)
Adult (male)c 0 (0) 0 (0)
Adult (female)c 1 (1) 0 (0)
I. nipponensis Larvaa 12 (1) 1 (8.3)
Nymphb 11 (4) 3 (27.2)
Adult (male)c 0 (0) 0 (0)
Adult (female)c 0 (0) 0 (0)

Jeolla-do A. testudinarium Larvaa 0 (0) 0 (0)
Nymphb 1 (1) 0 (0)
Adult (male)c 0 (0) 0 (0)
Adult (female)c 0 (0) 0 (0)
H. flava Larvaa 0 (0) 0 (0)
Nymphb 159 (36) 2 (1.2)
Adult (male)c 7 (7) 1 (14.3)
Adult (female)c 7 (7) 0 (0)
H. longicornis Larvaa 30 (2) 0 (0)
Nymphb 473 (98) 38 (8.0)
Adult (male)c 0 (0) 0 (0)
Adult (female)c 2 (2) 1 (50.0)
I. nipponensis Larvaa 0 (0) 0 (0)
Nymphb 6 (4) 3 (50.0)
Adult (male)c 0 (0) 0 (0)
Adult (female)c 0 (0) 0 (0)

Total (%) 2,814 (284) 88 (3.1)

a 1–39 larvae per pool,

b 1–7 nymphs per pool,

c 1 adults per pool.

Table 3
Summary on nPCR results of ticks tested for 3 rickettsial target genes, ompA, ompB and sca4
Province Species No. of tested tick pools ompAa (%) ompBa (%) sca4a (%)
Northwestern
 Incheon H. flava 2 0 (0) 1 (50.0) 1 (50.0)
H. longicornis 31 20 (64.5) 11 (35.4) 15 (48.3)
I. nipponensis 0 0 (0) 0 (0) 0 (0)
Subtotal 33 20 (60.6) 12 (36.3) 16 (48.4)
H. flava 4 0 (0) 0 (0) 0 (0)

Southwestern
 Chungcheong-do H. longicornis 2 2 (100.0) 2 (100.0) 2 (100.0)
I. nipponensis 4 2 (50.0) 0 (0) 4 (100.0)
Subtotal 10 4 (40.0) 2 (20.0) 6 (60.0)
 Jeolla-do H. flava 3 3 (100.0) 0 (0) 0 (0)
H. longicornis 39 36 (92.3) 29 (74.3) 32 (82.1)
I. nipponensis 3 3 (100.0) 1 (33.3) 3 (100.0)
Subtotal 45 42 (93.3) 30 (66.6) 35 (77.7)

Total 88 66 (75.0) 44 (50.0) 57 (64.7)

a MFIR (Minimum field infection rate)=No. of positive pools/No. of tested tick in pools×100.

Editorial Office
c/o Department of Medical Environmental Biology
Chung-AngUniversity College of Medicine, Dongjak-gu, Seoul 06974, Korea
Tel: +82-2-820-5683   Fax: +82-2-826-1123   E-mail: kjp.editor@gmail.com
About |  Browse Articles |  Current Issue |  For Authors and Reviewers
Copyright © 2019 by The Korean Society for Parasitology and Tropical Medicine. All rights reserved.     powerd by m2community